CRISPResso version 2.3.2 [Command used]: /opt/conda/bin/CRISPResso -r1 allele_specific.fastq.gz -a CGAGAGCCGCAGCCATGAACGGCACAGAGGGCCCCAATTTTTATGTGCCCTTCTCCAACGTCACAGGCGTGGTGCGGAGCCACTTCGAGCAGCCGCAGTACTACCTGGCGGAACCATGGCAGTTCTCCATGCTGGCAGCGTACATGTTCCTGCTCATCGTGCTGGG,CGAGAGCCGCAGCCATGAACGGCACAGAGGGCCCCAATTTTTATGTGCCCTTCTCCAACGTCACAGGCGTGGTGCGGAGCCCCTTCGAGCAGCCGCAGTACTACCTGGCGGAACCATGGCAGTTCTCCATGCTGGCAGCGTACATGTTCCTGCTCATCGTGCTGGG -an P23H,WT -g GTGCGGAGCCACTTCGAGCAGC --write_cleaned_report --place_report_in_output_folder [Execution log]: CRISPRessoPro not installed Computing quantification windows Added 0 guides with flexible matching Original flexiguides: ['None'] Found guides: [] Mismatch locations: [] Added 0 guides with flexible matching Original flexiguides: ['None'] Found guides: [] Mismatch locations: [] Aligning sequences... Finished reading fastq file; 4387 unique reads found of 25000 total reads found Processing Reads; 0 Completed out of 4387 Unique Reads Finished reads; N_TOT_READS: 25000 N_COMPUTED_ALN: 4219 N_CACHED_ALN: 20407 N_COMPUTED_NOTALN: 168 N_CACHED_NOTALN: 206 Done! Quantifying indels/substitutions... Done! Calculating allele frequencies... Done! Saving processed data... Making Plots... Plotting read bar plot Plotting read class pie chart and bar plot Begin processing plots for amplicon P23H Plotting nucleotide quilt across amplicon Plotting nucleotide distribuition around sgRNA GTGCGGAGCCACTTCGAGCAGC for P23H Plotting indel size distribution for P23H Plotting frequency deletions/insertions for P23H Plotting amplication modifications for P23H Plotting modification frequency for P23H Plotting quantification window locations for P23H Plotting position dependent indel for P23H Plotting allele distribution around cut for P23H Done! Begin processing plots for amplicon WT Plotting nucleotide quilt across amplicon Plotting nucleotide distribuition around sgRNA GTGCGGAGCCACTTCGAGCAGC for WT Plotting indel size distribution for WT Plotting frequency deletions/insertions for WT Plotting amplication modifications for WT Plotting modification frequency for WT Plotting quantification window locations for WT Plotting position dependent indel for WT Plotting allele distribution around cut for WT Done! Done! Removing Intermediate files... Disproportionate percentages of reads were aligned to amplicon: P23H, Percent of aligned reads aligned to this amplicon: 45.21%. Disproportionate percentages of reads were aligned to amplicon: WT, Percent of aligned reads aligned to this amplicon: 51.0%. >=1.0% of reads have modifications at the start or end. Total reads: 24626, Irregular reads: 2114. >=0.2% of substitutions were outside of the quantification window. Total substitutions: 7154, Substitutions outside window: 6891. Analysis Complete! _ ' ) .-' (____ C)| \ \ / \___/