CRISPResso version 2.3.2 [Command used]: /opt/conda/bin/CRISPResso --fastq_r1 base_editor.fastq.gz --amplicon_seq GGCCCCAGTGGCTGCTCTGGGGGCCTCCTGAGTTTCTCATCTGTGCCCCTCCCTCCCTGGCCCAGGTGAAGGTGTGGTTCCAGAACCGGAGGACAAAGTACAAACGGCAGAAGCTGGAGGAGGAAGGGCCTGAGTCCGAGCAGAAGAAGAAGGGCTCCCATCACATCAACCGGTGGCGCATTGCCACGAAGCAGGCCAATGGGGAGGACATCGATGTCACCTCCAATGACTAGGGTGG --guide_seq GAGTCCGAGCAGAAGAAGAA --quantification_window_size 20 --quantification_window_center -10 --base_editor_output --write_cleaned_report --place_report_in_output_folder [Execution log]: CRISPRessoPro not installed Computing quantification windows Added 0 guides with flexible matching Original flexiguides: ['None'] Found guides: [] Mismatch locations: [] Aligning sequences... Finished reading fastq file; 3939 unique reads found of 25000 total reads found Processing Reads; 0 Completed out of 3939 Unique Reads Finished reads; N_TOT_READS: 25000 N_COMPUTED_ALN: 3909 N_CACHED_ALN: 21061 N_COMPUTED_NOTALN: 30 N_CACHED_NOTALN: 0 Done! Quantifying indels/substitutions... Done! Calculating allele frequencies... Done! Saving processed data... Making Plots... Plotting read bar plot Plotting read class pie chart and bar plot Begin processing plots for amplicon Reference Plotting nucleotide quilt across amplicon Plotting nucleotide distribuition around sgRNA GAGTCCGAGCAGAAGAAGAA for Reference Plotting indel size distribution for Reference Plotting frequency deletions/insertions for Reference Plotting amplication modifications for Reference Plotting modification frequency for Reference Plotting quantification window locations for Reference Plotting position dependent indel for Reference Plotting substitutions across reference for Reference Plotting substitution frequency barplot for Reference Plotting substitution frequency barplot in quantification window for Reference Plotting allele distribution around cut for Reference Plotting log2 nucleotide frequency for Reference Plotting conversion at Cs around the sgRNA GAGTCCGAGCAGAAGAAGAA for Reference Plotting non-reference conversion at Cs around the sgRNA GAGTCCGAGCAGAAGAAGAA for Reference Plotting scaled non-reference conversion at Cs around the sgRNA GAGTCCGAGCAGAAGAAGAA for Reference Done! Done! Removing Intermediate files... >=1.0% of reads have modifications at the start or end. Total reads: 24970, Irregular reads: 24970. >=0.2% of substitutions were outside of the quantification window. Total substitutions: 17498, Substitutions outside window: 4061. Analysis Complete! _ ' ) .-' (____ C)| \ \ / \___/