CRISPResso version 2.3.2
[Command used]:
/opt/conda/bin/CRISPResso --fastq_r1 prime_editor.fastq.gz --amplicon_seq ACGTCTCATATGCCCCTTGGCAGTCATCTTAGTCATTACCTGAGGTGTTCGTTGTAACTCATATAAACTGAGTTCCCATGTTTTGCTTAATGGTTGAGTTCCGTTTGTCTGCACAGCCTGAGACATTGCTGGAAATAAAGAAGAGAGAAAAACAATTTTAGTATTTGGAAGGGAAGTGCTATGGTCTGAATGTATGTGTCCCACCAAAATTCCTACGT --prime_editing_pegRNA_spacer_seq GTCATCTTAGTCATTACCTG --prime_editing_pegRNA_extension_seq AACGAACACCTCATGTAATGACTAAGATG --prime_editing_nicking_guide_seq CTCAACCATTAAGCAAAACAT --prime_editing_pegRNA_scaffold_seq GTTTTAGAGCTAGAAATAGCAAGTTAAAATAAGGCTAGTCCGTTATCAACTTGAAAAAGTGGCACCGAGTCGGTGC --write_cleaned_report --place_report_in_output_folder

[Execution log]:
CRISPRessoPro not installed
Computing quantification windows
Added 0 guides with flexible matching
	Original flexiguides: ['None']
	Found guides: []
	Mismatch locations: []
Added 0 guides with flexible matching
	Original flexiguides: ['None']
	Found guides: []
	Mismatch locations: []
Aligning sequences...
Processing pegRNA scaffold sequence...
Searching for scaffold-templated reads with the sequence: 'GC' starting at position 53 in reads that align to the prime-edited sequence
Finished reading fastq file; 5557 unique reads found of 25000 total reads found 
Processing Reads; 0 Completed out of 5557 Unique Reads
Finished reads; N_TOT_READS: 25000 N_COMPUTED_ALN: 5471 N_CACHED_ALN: 19440 N_COMPUTED_NOTALN: 86 N_CACHED_NOTALN: 3
Done!
Quantifying indels/substitutions...
Done!
Calculating allele frequencies...
Done!
Saving processed data...
Making Plots...
Plotting read bar plot
Plotting read class pie chart and bar plot
Begin processing plots for amplicon Reference
Plotting nucleotide quilt across amplicon
Plotting nucleotide distribuition around PE Extension (AACGAACACCTCATGTAATGACTAAGATG) for Reference
Plotting nucleotide distribuition around PE spacer sgRNA (GTCATCTTAGTCATTACCTG) for Reference
Plotting nucleotide distribuition around PE nicking sgRNA (CTCAACCATTAAGCAAAACAT) for Reference
Plotting indel size distribution for Reference
Plotting frequency deletions/insertions for Reference
Plotting amplication modifications for Reference
Plotting modification frequency for Reference
Plotting quantification window locations for Reference
Plotting position dependent indel for Reference
Plotting allele distribution around cut for Reference
Plotting allele distribution around cut for Reference
Plotting allele distribution around cut for Reference
Done!
Begin processing plots for amplicon Prime-edited
Plotting nucleotide quilt across amplicon
Plotting nucleotide distribuition around PE Extension (AACGAACACCTCATGTAATGACTAAGATG) for Prime-edited
Plotting nucleotide distribuition around PE spacer sgRNA (GTCATCTTAGTCATTACCTG) for Prime-edited
Plotting nucleotide distribuition around PE nicking sgRNA (CTCAACCATTAAGCAAAACAT) for Prime-edited
Plotting indel size distribution for Prime-edited
Plotting frequency deletions/insertions for Prime-edited
Plotting amplication modifications for Prime-edited
Plotting modification frequency for Prime-edited
Plotting quantification window locations for Prime-edited
Plotting position dependent indel for Prime-edited
Plotting allele distribution around cut for Prime-edited
Plotting allele distribution around cut for Prime-edited
Plotting allele distribution around cut for Prime-edited
Done!
Begin processing plots for amplicon Scaffold-incorporated
Plotting nucleotide quilt across amplicon
Plotting nucleotide distribuition around PE Extension (AACGAACACCTCATGTAATGACTAAGATG) for Scaffold-incorporated
Plotting nucleotide distribuition around PE spacer sgRNA (GTCATCTTAGTCATTACCTG) for Scaffold-incorporated
Plotting nucleotide distribuition around PE nicking sgRNA (CTCAACCATTAAGCAAAACAT) for Scaffold-incorporated
Plotting indel size distribution for Scaffold-incorporated
Plotting frequency deletions/insertions for Scaffold-incorporated
Plotting amplication modifications for Scaffold-incorporated
Plotting modification frequency for Scaffold-incorporated
Plotting quantification window locations for Scaffold-incorporated
Plotting position dependent indel for Scaffold-incorporated
Plotting allele distribution around cut for Scaffold-incorporated
Plotting allele distribution around cut for Scaffold-incorporated
Plotting allele distribution around cut for Scaffold-incorporated
Done!
Processing pegRNA scaffold sequence...
Searching for scaffold-templated reads with the sequence: 'GC' starting at position 53 in reads that align to the prime-edited sequence
Plotting prime editing nucleotide percentage quilt
Plotting nucleotide quilt
Plotting nucleotide quilt
Plotting nucleotide quilt
Plotting scaffold insertion sizes
Done!
Removing Intermediate files...
 Disproportionate percentages of reads were aligned to amplicon: Reference, Percent of aligned reads aligned to this amplicon: 57.59%.
 Disproportionate percentages of reads were aligned to amplicon: Prime-edited, Percent of aligned reads aligned to this amplicon: 38.94%.
 Disproportionate percentages of reads were aligned to amplicon: Scaffold-incorporated, Percent of aligned reads aligned to this amplicon: 2.12%.
 >=1.0% of reads have modifications at the start or end. Total reads: 24911, Irregular reads: 24907.
 >=0.2% of substitutions were outside of the quantification window. Total substitutions: 6550, Substitutions outside window: 5668.
Analysis Complete!
                                                                               
                                        _                                      
                                       '  )                                    
                                       .-'                                     
                                      (____                                    
                                   C)|     \                                   
                                     \     /                                   
                                      \___/